Sample Case
Canine mammary tumor · 18 somatic variants · 4 neoantigen candidates (TP53, PIK3CA) · real pipeline output, no edits.
Job Initialization
Case Queued
Your VCF file has been received and queued on our compute cluster. The job will start momentarily.
pVACseq · DLA Binding Prediction
Neoantigen Prediction
pVACseq is scanning every tumor mutation against your DLA alleles to identify peptides that could train the immune system to recognize and attack cancer cells.
Composite Scoring & Filtering
Candidate Ranking
Candidates are filtered by binding affinity (IC50 < 500 nM) and tumor allele frequency, then ranked by a composite immunogenicity score.
| Rank | Peptide | Gene | Length | Allele | IC50 (nM) | VAF | Score |
|---|---|---|---|---|---|---|---|
| 1 | MPMCEFDMVK | PIK3CA | 10 | DLA-8850801 | 128.4 | 60.0% | 0.852 |
| 2 | RYMSEHRLM | TP53 | 9 | DLA-8850101 | 89.2 | 55.0% | 0.781 |
| 3 | YPELKVNVK | BRCA2 | 9 | DLA-8850801 | 156.8 | 48.0% | 0.624 |
| 4 | VTLAYDLAA | KIT | 9 | DLA-8850101 | 215.3 | 52.0% | 0.547 |
| 5 | RAVMPVDMK | PTEN | 9 | DLA-8850801 | 304.7 | 45.0% | 0.412 |
Binding affinity and mutation-landscape charts are generated, then Gemma 4 interprets the data into a clinician-ready narrative highlighting the most actionable candidates.
Binding Affinity (IC50)
Mutation Landscape
Clinical Report
Save as PDFClinical Neoantigen Analysis Report
Case Summary This report analyzes a tumor DNA sample from a canine patient (Canis lupus familiaris) with mammary carcinoma. A total of 304 somatic mutations were analyzed against the patient's DLA-8850101 and DLA-8850801 class I alleles to identify potential neoantigens — tumor-specific peptides that could serve as targets for a personalized cancer vaccine. After computational filtering (IC50 < 500 nM and tumor VAF ≥ 0.30), 12 candidates passed; the top 7 are presented here for vaccine design consideration.
Top Vaccine Candidates
The strongest candidate is MPMCEFDMVK, derived from a PIK3CA p.Val125Met missense mutation. It binds DLA-88*50801 with an IC50 of 128 nM (strong-to-moderate range) and is present in 60% of tumor reads (h
…
Top epitopes are back-translated using canine codon tables and assembled into a synthesis-ready construct with UTRs, Kozak sequence, and poly-A tail. Gemma 4 generates the CMO-ready synthesis specification.
mRNA Sequence (FASTA)
>BUDDY_TUMOR_DEMO_neoantigen_vaccine | epitopes=MPMCEFDMVK+RYMSEHRLM+YPELKVNVK | genes=PIK3CA+TP53+BRCA2 | species=canis_lupus_familiaris | gc=0.341 | length=323nt ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACGCCACCATGAT GCCCATGTGCGAGTTCGACATGGTGAAGGCCGCCTACAGGTACATGAGCGAGCACAGGCT …
Synthesis Specification
Save as PDFmRNA Synthesis Specification — Personalized Neoantigen Vaccine
| Order ID | ROSIE-BUDDY_TUMOR_DEMO-20260510 |
| Sample | BUDDY_TUMOR_DEMO |
| Patient species | Canine (Canis lupus familiaris) |
| Date generated | 10 May 2026 |
| Document classification | Research Use Only · Investigational material |
1. Synthesis Request Summary
This document specif
Pipeline Complete
Results Ready
Your personalized vaccine design is complete. All artifacts are ready for review with your oncologist.
Ask Rosie
Clinical AI Assistant