Sample Case

Canine mammary tumor · 18 somatic variants · 4 neoantigen candidates (TP53, PIK3CA) · real pipeline output, no edits.

Submit your own VCF →

Job Initialization

Case Queued

Your VCF file has been received and queued on our compute cluster. The job will start momentarily.

pVACseq · DLA Binding Prediction

Neoantigen Prediction

pVACseq is scanning every tumor mutation against your DLA alleles to identify peptides that could train the immune system to recognize and attack cancer cells.

Composite Scoring & Filtering

Candidate Ranking

Candidates are filtered by binding affinity (IC50 < 500 nM) and tumor allele frequency, then ranked by a composite immunogenicity score.

304mutations analyzed
12after filtering
7top candidates
RankPeptideGeneLengthAlleleIC50 (nM)VAFScore
1MPMCEFDMVKPIK3CA10DLA-8850801128.460.0%0.852
2RYMSEHRLMTP539DLA-885010189.255.0%0.781
3YPELKVNVKBRCA29DLA-8850801156.848.0%0.624
4VTLAYDLAAKIT9DLA-8850101215.352.0%0.547
5RAVMPVDMKPTEN9DLA-8850801304.745.0%0.412

Charts · AI Clinical Report

Report Generation

Download Report✦ Gemma 4

Binding affinity and mutation-landscape charts are generated, then Gemma 4 interprets the data into a clinician-ready narrative highlighting the most actionable candidates.

Binding Affinity (IC50)

Binding Affinity (IC50)

Mutation Landscape

Mutation Landscape

Clinical Report

Save as PDF

Clinical Neoantigen Analysis Report

Case Summary This report analyzes a tumor DNA sample from a canine patient (Canis lupus familiaris) with mammary carcinoma. A total of 304 somatic mutations were analyzed against the patient's DLA-8850101 and DLA-8850801 class I alleles to identify potential neoantigens — tumor-specific peptides that could serve as targets for a personalized cancer vaccine. After computational filtering (IC50 < 500 nM and tumor VAF ≥ 0.30), 12 candidates passed; the top 7 are presented here for vaccine design consideration.

Top Vaccine Candidates

The strongest candidate is MPMCEFDMVK, derived from a PIK3CA p.Val125Met missense mutation. It binds DLA-88*50801 with an IC50 of 128 nM (strong-to-moderate range) and is present in 60% of tumor reads (h

mRNA Assembly · Gemma 4 Synthesis Spec

mRNA Vaccine Design

✦ Gemma 4

Top epitopes are back-translated using canine codon tables and assembled into a synthesis-ready construct with UTRs, Kozak sequence, and poly-A tail. Gemma 4 generates the CMO-ready synthesis specification.

mRNA Sequence (FASTA)

>BUDDY_TUMOR_DEMO_neoantigen_vaccine | epitopes=MPMCEFDMVK+RYMSEHRLM+YPELKVNVK | genes=PIK3CA+TP53+BRCA2 | species=canis_lupus_familiaris | gc=0.341 | length=323nt
ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACGCCACCATGAT
GCCCATGTGCGAGTTCGACATGGTGAAGGCCGCCTACAGGTACATGAGCGAGCACAGGCT
…

Synthesis Specification

Save as PDF

mRNA Synthesis Specification — Personalized Neoantigen Vaccine

Order IDROSIE-BUDDY_TUMOR_DEMO-20260510
SampleBUDDY_TUMOR_DEMO
Patient speciesCanine (Canis lupus familiaris)
Date generated10 May 2026
Document classificationResearch Use Only · Investigational material

1. Synthesis Request Summary

This document specif

Pipeline Complete

Results Ready

Your personalized vaccine design is complete. All artifacts are ready for review with your oncologist.

🐾

Ask Rosie

Clinical AI Assistant

🐾
Hi, I'm Rosie, your clinical AI assistant. I have full context on this case: the ranked neoantigen candidates, binding affinity scores, clinical report, and mRNA design. Ask me anything.